Talk:Pseudoknot

	This article is within the scope of WikiProject Molecular Biology, a collaborative effort to improve the coverage of Molecular Biology on Wikipedia. If you would like to participate, please visit the project page, where you can join the discussion and see a list of open tasks.Molecular BiologyWikipedia:WikiProject Molecular BiologyTemplate:WikiProject Molecular BiologyMolecular Biology articles
???	This article has not yet received a rating on the importance scale.
	This article is supported by the Molecular and Cell Biology task force (assessed as Low-importance).

Diagram

Previous version contained only one sentence that was copied directly from the reference. Now, maybe someone could make a nice image that's better than my sorry ascii art? Opabinia regalis 03:38, 23 May 2006 (UTC)[reply]

I'm no molecular biologist, but this shouldn't be too difficult. I did a quick search at Google and it seems that most pseudoknot diagrams include letters to indicate various RNA bases (see e.g., [1]). Rather than copying one of these images directly, I assume it would be safer to use a base sequence that hasn't been copied from somewhere else. Can you provide an example? If you like, you can use the bracket-view notation described in [2].

Sakurambo 13:11, 23 May 2006 (UTC)[reply]

Thanks. I'd make one myself but I have no art skills whatsoever. Here's a short sequence I just made up (so no guarantees that the base pairing, stacking, etc. are favorable):

  ACUGCAAGUACCGAUUUGCAGGCAAUCGACG
  ---[[[[----((((]]]]-----))))---

And here's one that actually exists (telomerase pseudoknot):

  UCGACUGUAAAAAA - (loop) - GCGGGCGACUUUCAGUCGCUCUUUUUGUCGCGCGC 
  -[[[[[[^[[[---------------(((((((((]]]]]]]]]--------)))))-)))

For clarity: the U represented with a carat is an internal bulge; the G on the other end is just mispaired.

(I just added this reference to the main article.) Opabinia regalis 07:23, 24 May 2006 (UTC)[reply]

OK, I'll see what I can do. The shorter one should be easy enough, so I'll work on that to start with. Do you reckon it's OK to use the longer one even if it's from a copyrighted paper? Also, if the "G" is unpaired, then I assume its opposite partner is also unpaired, i.e.:

  UCGACUGUAAAAAA - (loop) - GCGGGCGACUUUCAGUCGCUCUUUUUGUCGCGCGC 
  -[[[[[[^[[[---------------(((-(((((]]]]]]]]]--------)))))-)))

Sakurambo 08:36, 24 May 2006 (UTC)[reply]

You're right, they're both mispaired, thanks. I can't imagine it would be a problem to display a sequence that exists in nature - the sequence itself isn't copyrighted and wasn't designed by the authors (they aren't even the discoverers). I'd think just noting somewhere that it was taken from the Chen paper would be sufficient. Opabinia regalis 09:08, 24 May 2006 (UTC)[reply]

OK then. Does this look alright?

Let me know if anything needs changing. -- Sakurambo 11:22, 24 May 2006 (UTC)[reply]

That's awesome, thanks! I just put it in the article - let me know if you want a link/credit notice/etc. Out of curiosity, what did you use to make that? Opabinia regalis 15:42, 24 May 2006 (UTC)[reply]

Adobe Illustrator. For some reason, version 10 produces invalid SVG files, but they can be fixed easily enough in a text editor. Don't worry about attribution; it didn't take all that long :-) Sakurambo 16:38, 24 May 2006 (UTC)[reply]